Skip to main content

pFP60
(Plasmid #247216)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 247216 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pJL1
  • Total vector size (bp) 2576
  • Modifications to backbone
    The Dimeric Pepper RNA aptamer (with F30 scaffold) was inserted into pJL1 downstream of the sfGFP gene. The T7 promoter was replaced with Pj23100 (Anderson promoter catalog).
  • Vector type
    Bacterial Expression, Synthetic Biology ; E. coli-based cell-free expression.

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    E. coli DH5alpha and DH10B are suitable for growth.
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    superfolder GFP
  • Alt name
    sfGFP
  • Alt name
    sfGFP-strepTag
  • Insert Size (bp)
    723
  • Promoter Pj23100 (ttgacggctagctcagtcctaggtacagtgctagc)
  • Tag / Fusion Protein
    • Streptavidin tag (C terminal on insert)

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    Dimeric Pepper RNA aptamer (with F30 scaffold)
  • Alt name
    DF30ppr
  • Insert Size (bp)
    140
  • Mutation
    Two mutations were made to the second Pepper unit (G9A and C42T)
  • Promoter Pj23100 (ttgacggctagctcagtcctaggtacagtgctagc)

Cloning Information for Gene/Insert 2

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The Pepper RNA aptamer was originally developed by Chen et al. (https://doi.org/10.1038/s41587-019-0249-1) and grafted onto an F30 scaffold by Mumbleau et al. (https://doi.org/10.1021/acssynbio.4c00009) To insert the aptamer into pJL1, we purchased the Pepper aptamer sequence from Integrated DNA Technologies (IDT) as part of a gBlock with two point mutations in one of the Pepper units to increase the likelihood of successful synthesis.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFP60 was a gift from Elizabeth Strychalski (Addgene plasmid # 247216 ; http://n2t.net/addgene:247216 ; RRID:Addgene_247216)
  • For your References section:

    Characterizing Cell-Free Transcription and Translation Dynamics with Nucleic Acid-Based Assays. Piorino F, Sundberg C, Strychalski EA, Romantseva E. ACS Synth Biol. 2026 Jan 16;15(1):243-261. doi: 10.1021/acssynbio.5c00677. Epub 2025 Dec 24. 10.1021/acssynbio.5c00677 PubMed 41444210