pAcGFP-N1_CBPIDR6shuffle
(Plasmid
#247245)
-
PurposeTo transiently express GFP-tagged CBP with a shuffled sequence of IDR6 in mammalian cells
-
Depositing Lab
-
Depositing OrganizationUniversity of Sheffield
Located in United Kingdom of Great Britain and Northern Ireland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 247245 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepAcGFP-N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4726
- Total vector size (bp) 12052
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCREB binding protein (CBP)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)7326
-
MutationAmino acids within the IDR6 region, CBP aa 1856 - 2090, have been shuffled, where the overall sequence composition was maintained but the sequence was randomly shuffled to disrupt the sequence patterning.
-
Entrez GeneCREBBP (a.k.a. CBP, KAT3A, MKHK1, RSTS, RSTS1)
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTCAGATCCGCTAGCGCTAC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.06.04.597392 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAcGFP-N1_CBPIDR6shuffle was a gift from Daniel Bose (Addgene plasmid # 247245 ; http://n2t.net/addgene:247245 ; RRID:Addgene_247245) -
For your References section:
CBP-IDRs regulate acetylation and gene expression. Gelder KL, Carruthers NA, Gilbert G, Harrison LJ, Evans BV, Evans TI, Ball SS, Dunning M, Craggs TD, Twelvetrees AE, Bose DA. Cell Rep. 2026 Mar 12;45(3):117109. doi: 10.1016/j.celrep.2026.117109. 10.1016/j.celrep.2026.117109 PubMed 41824454