pFBOH-MHL_DDX1:1-674
(Plasmid
#247531)
-
PurposeBaculovirus expression for protein production. May not contain entire coding region of gene.
-
Depositing Lab
-
Depositing OrganizationUniversity of Toronto
Located in Canada -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 247531 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepFBOH-MHL
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDDX1
-
SpeciesH. sapiens (human)
-
MutationLoop Deletion of residues 75-285 with "sgsgsg" linker
-
Entrez GeneDDX1 (a.k.a. DBP-RB, UKVH5d)
- Promoter Polyhedrin
-
Tag
/ Fusion Protein
- MHHHHHHSSGRENLYFQG (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer pFBOH-fwd (CCGGATTATTCATACCGTCCCACCA)
- 3′ sequencing primer pFBOH-rev (5'-CTGATTATGATCCTCTAGTACTTCT-3')
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byMammalian Gene Collection (BC012132.1)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFBOH-MHL_DDX1:1-674 was a gift from Cheryl Arrowsmith (Addgene plasmid # 247531 ; http://n2t.net/addgene:247531 ; RRID:Addgene_247531)