PX330-TH-sgRNA-2
(Plasmid
#247674)
-
PurposeAll-in-one CRISPR construct targeting TH
-
Depositing Lab
-
Depositing OrganizationNational Human Genome Research Institute (NHGRI)
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 247674 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepX330
-
Backbone manufacturerFeng Zhang, Addgene plasmid #42230
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersEGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTH sgRNA 2
-
gRNA/shRNA sequencetaggtgcacggcgtccctga
-
SpeciesH. sapiens (human)
-
Entrez GeneTH (a.k.a. DYT14, DYT5b, TYH)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PX330-TH-sgRNA-2 was a gift from Ellen Sidransky (Addgene plasmid # 247674 ; http://n2t.net/addgene:247674 ; RRID:Addgene_247674) -
For your References section:
Evaluation of Induced Pluripotent Stem Cell-Derived Dopaminergic Neurons from Siblings with Gaucher Disease Discordant for Parkinsonism. Hertz E, Rytel K, Perez G, Hao Y, Li Z, Ma C, Andersh K, Qi YA, Ryan E, Lopez G, Tayebi N, Sidransky E, Chen Y. Mov Disord. 2025 Aug;40(8):1719-1724. doi: 10.1002/mds.30273. Epub 2025 Jun 26. 10.1002/mds.30273 PubMed 40568761