Skip to main content

pAAV_3x_U6_Cldn5_CAG_nlsTagBFP2
(Plasmid #247679)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 247679 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    AAV
  • Backbone size w/o insert (bp) 2597
  • Total vector size (bp) 6581
  • Vector type
    Mammalian Expression, Mouse Targeting, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Cldn5 sgRNAs
  • Alt name
    Three Cldn5 targeting gRNA cassettes
  • gRNA/shRNA sequence
    GTCTGCGCCGTCACGATGTTG,GCACGGGAGGAGCGCTTTACG,GGTGCACTGAGCGCCGGTCA
  • Species
    M. musculus (mouse)
  • Promoter U6
  • Tag / Fusion Protein
    • nls-TagBFP2

Cloning Information

  • Cloning method Golden Gate
  • 5′ sequencing primer TGTAAAACGACGGCCAGT
  • 3′ sequencing primer CGTCAATAGGGGGCGTACTTG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV_3x_U6_Cldn5_CAG_nlsTagBFP2 was a gift from Benoit Vanhollebeke (Addgene plasmid # 247679 ; http://n2t.net/addgene:247679 ; RRID:Addgene_247679)
  • For your References section:

    Scalable and multimodal brain angiogenesis and blood-brain barrier genetics by somatic mutagenesis. Panji JM, Germano RFV, America M, Lou L, Lecordier L, Tebabi P, Martin M, Vanhollebeke B. Commun Biol. 2026 Feb 25;9(1):479. doi: 10.1038/s42003-026-09747-z. 10.1038/s42003-026-09747-z PubMed 41735520