pAAV_3x_U6_Cldn5_CAG_nlsTagBFP2
(Plasmid #247679)

• Purpose: Targeting Cldn5 gene in vivo by adeno-associated viral vector-mediated delivery
• Depositing Lab: Benoit Vanhollebeke
• Publication: Panji et al Commun Biol. 2026 Feb 25;9(1):479. doi: 10.1038/s42003-026-09747-z.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $34 USD for plasmid.
• How this works:
  • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: AAV
• Backbone size w/o insert (bp): 2597
• Total vector size (bp): 6581
• Vector type: Mammalian Expression, Mouse Targeting, AAV, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Cldn5 sgRNAs
• Alt name: Three Cldn5 targeting gRNA cassettes
• gRNA/shRNA sequence: GTCTGCGCCGTCACGATGTTG,GCACGGGAGGAGCGCTTTACG,GGTGCACTGAGCGCCGGTCA
• Species: M. musculus (mouse)
• Promoter: U6
• Tag / Fusion Protein:
  • nls-TagBFP2

Cloning Information

• Cloning method: Golden Gate
• 5′ sequencing primer: TGTAAAACGACGGCCAGT
• 3′ sequencing primer: CGTCAATAGGGGGCGTACTTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry