pAAV_3x_U6_Ctnnb1_CAG_nlsTagBFP2
(Plasmid
#247933)
-
PurposeTargeting Ctnnb1 gene in vivo by adeno-associated viral vector-mediated delivery
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 247933 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $34 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backboneAAV
- Backbone size w/o insert (bp) 2597
- Total vector size (bp) 6580
-
Vector typeMammalian Expression, Mouse Targeting, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCtnnb1 sgRNAs
-
Alt nameThree Ctnnb1 targeting gRNA cassettes
-
gRNA/shRNA sequenceGCGTGGACAATGGCTACTCA,GTGACCTGATGGAGTTGGACA,GTTGGACATGGCCATGGAGC
-
SpeciesM. musculus (mouse)
-
Entrez GeneCtnnb1 (a.k.a. Bfc, Catnb, Mesc)
- Promoter U6
-
Tag
/ Fusion Protein
- nls-TagBFP2
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer TGTAAAACGACGGCCAGT
- 3′ sequencing primer CGTCAATAGGGGGCGTACTTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV_3x_U6_Ctnnb1_CAG_nlsTagBFP2 was a gift from Benoit Vanhollebeke (Addgene plasmid # 247933 ; http://n2t.net/addgene:247933 ; RRID:Addgene_247933) -
For your References section:
Scalable and multimodal brain angiogenesis and blood-brain barrier genetics by somatic mutagenesis. Panji JM, Germano RFV, America M, Lou L, Lecordier L, Tebabi P, Martin M, Vanhollebeke B. Commun Biol. 2026 Feb 25;9(1):479. doi: 10.1038/s42003-026-09747-z. 10.1038/s42003-026-09747-z PubMed 41735520