Skip to main content

pAAV_3x_U6_Ikbkg_CAG_nlsTagBFP2
(Plasmid #247934)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 247934 Standard format: Plasmid sent in bacteria as agar stab 1 $94

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    AAV
  • Backbone size w/o insert (bp) 2597
  • Total vector size (bp) 6582
  • Vector type
    Mammalian Expression, Mouse Targeting, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Ikbkg sgRNAs
  • Alt name
    Three Ikbkg targeting gRNA cassettes
  • gRNA/shRNA sequence
    GTGGGTGAAGAATCTTCTCTG, GAGGCTGCCTTGCGAATGGAG, GATTTGGCCTTGTCCAACCAG
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Ikbkg (a.k.a. 1110037D23Rik, IKK[g], NEMO)
  • Promoter U6
  • Tag / Fusion Protein
    • nls-TagBFP2

Cloning Information

  • Cloning method Golden Gate
  • 5′ sequencing primer TGTAAAACGACGGCCAGT
  • 3′ sequencing primer CGTCAATAGGGGGCGTACTTG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV_3x_U6_Ikbkg_CAG_nlsTagBFP2 was a gift from Benoit Vanhollebeke (Addgene plasmid # 247934 ; http://n2t.net/addgene:247934 ; RRID:Addgene_247934)
  • For your References section:

    Scalable and multimodal brain angiogenesis and blood-brain barrier genetics by somatic mutagenesis. Panji JM, Germano RFV, America M, Lou L, Lecordier L, Tebabi P, Martin M, Vanhollebeke B. Commun Biol. 2026 Feb 25;9(1):479. doi: 10.1038/s42003-026-09747-z. 10.1038/s42003-026-09747-z PubMed 41735520