pAAV_3x_U6_Slc2a1_CAG_nlsTagBFP2
(Plasmid
#247936)
-
PurposeTargeting Slc2a1 gene in vivo by adeno-associated viral vector-mediated delivery
-
Depositing Lab
-
Depositing OrganizationUniversite Libre de Bruxelles
Located in Belgium -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 247936 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneAAV
- Backbone size w/o insert (bp) 2597
- Total vector size (bp) 6581
-
Vector typeMammalian Expression, Mouse Targeting, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameSlc2a1 sgRNAs
-
Alt nameThree Slc2a1 targeting gRNA cassettes
-
gRNA/shRNA sequenceGCAAACATGGAACCACCGCTA, GTGTCACCTACAGCTCTACG, GCCTGCTCATCAATCGTAACG
-
SpeciesM. musculus (mouse)
-
Entrez GeneSlc2a1 (a.k.a. GT1, Glut-1, Glut1, M100200, Rgsc200)
- Promoter U6
-
Tag
/ Fusion Protein
- nls-TagBFP2
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer TGTAAAACGACGGCCAGT
- 3′ sequencing primer CGTCAATAGGGGGCGTACTTG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV_3x_U6_Slc2a1_CAG_nlsTagBFP2 was a gift from Benoit Vanhollebeke (Addgene plasmid # 247936 ; http://n2t.net/addgene:247936 ; RRID:Addgene_247936) -
For your References section:
Scalable and multimodal brain angiogenesis and blood-brain barrier genetics by somatic mutagenesis. Panji JM, Germano RFV, America M, Lou L, Lecordier L, Tebabi P, Martin M, Vanhollebeke B. Commun Biol. 2026 Feb 25;9(1):479. doi: 10.1038/s42003-026-09747-z. 10.1038/s42003-026-09747-z PubMed 41735520