pGIPZ EF1a myc tagged mbIL2 IRES miRFP720-P2A-Blast
(Plasmid
#248031)
-
PurposeConstitutively expresses myc tagged membrane bound IL2, miRFP720 and a blasticidin resistance gene in human cells
-
Depositing Lab
-
Depositing OrganizationNorthwestern University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 248031 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepGIPZ
- Backbone size w/o insert (bp) 12121
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersBlasticidin ; and miRFP720
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemyc-tagged membrane bound IL2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2148
-
Entrez GeneIL2 (a.k.a. IL-2, TCGF, lymphokine)
- Promoter human EF1a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer atagaagaGaAcgggaccg
- 3′ sequencing primer cctcacattgccaaaagacg
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byStuart Forman (IL2 construct originally developed by Jounaidi et al., 2017; PMID 28916655)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Membrane bound IL2 construct: IL2 signal sequence-IL2-Myc tag-IL2RA linker-IL2RB.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGIPZ EF1a myc tagged mbIL2 IRES miRFP720-P2A-Blast was a gift from Joshua Leonard (Addgene plasmid # 248031 ; http://n2t.net/addgene:248031 ; RRID:Addgene_248031) -
For your References section:
Comparative Evaluation of Synthetic Cytokines for Enhancing Production and Performance of NK92 Cell-Based Therapies. Deol S, Donahue PS, Mitrut RE, Hammitt-Kess IJ, Ahn J, Zhang B, Leonard JN. GEN Biotechnol. 2023 Jun 1;2(3):228-246. doi: 10.1089/genbio.2023.0024. Epub 2023 Jun 19. 10.1089/genbio.2023.0024 PubMed 37363412