pGIPZ EF1a ACCx2 uORF eIL12 IRES mNeonGreen-P2A-Puro
(Plasmid
#248035)
-
PurposeConstitutively expresses an engineered version of IL12, mNeonGreen and a puromycin resistance gene in human cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 248035 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepGIPZ
- Backbone size w/o insert (bp) 12064
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin ; and mNeonGreen
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEngineered IL12
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1640
- Promoter human EF1a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer atagaagaGaAcgggaccg
- 3′ sequencing primer cctcacattgccaaaagacg
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
ACCx2 uORF (upstream open reading frame) diminishes level of mRNA translation. eIL12 construct: IL12B-linker-IL12A.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGIPZ EF1a ACCx2 uORF eIL12 IRES mNeonGreen-P2A-Puro was a gift from Joshua Leonard (Addgene plasmid # 248035 ; http://n2t.net/addgene:248035 ; RRID:Addgene_248035) -
For your References section:
Comparative Evaluation of Synthetic Cytokines for Enhancing Production and Performance of NK92 Cell-Based Therapies. Deol S, Donahue PS, Mitrut RE, Hammitt-Kess IJ, Ahn J, Zhang B, Leonard JN. GEN Biotechnol. 2023 Jun 1;2(3):228-246. doi: 10.1089/genbio.2023.0024. Epub 2023 Jun 19. 10.1089/genbio.2023.0024 PubMed 37363412