Skip to main content

pJM-RMC-01
(Plasmid #248660)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 248660 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pyrFEKO-Pur
  • Backbone manufacturer
    George Cross (Addgene # 24021)
  • Backbone size (bp) 5900
  • Vector type
    Trypanosoma knock out plasmid
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer CGACCGAGCGCAGCGAGTCA
  • 3′ sequencing primer GTGTCACCTAAA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid pJM-RMC-01 was made by swapping the relevant UTRs of EATRO1125 RAD51(Tb1125.11.8190) into pyrFEKO-PUR using restriction enzyme cloning. (pyrFEKO-PUR: Addgene plasmid # 24021; http://n2t.net/addgene:24021)
Briefly, UTRs were amplified from EATRO1125 90:13 gDNA with Phusion polymerase (NEB; 5’ UTR = F 5’-CAGCTGCGGCCGCAGGCAGTCAAAGCATGTCCA-3’ and R 5’-TCTAGAAGCTTCCCTGATATACGCGTTAAGA-3’; 3’ UTR = F 5’- GGATCCATGCATTTCCTCATCATTTGTAGAA-3’ and R 5’-CCTGCAGGCTCGAGAGTTACCTACAATTGCCTTC-3’) then ligated into pGEM-T Easy Vector (Promega) and confirmed via Sanger sequencing (Eurofins, Germany; with M13F).
Plasmid and inserts were digested with the following:
1) for the 5’UTR, PvuII-HF and HindIII-HF (both NEB)
2) for the 3’UTR, BamHI-HF and SbfI-HF (both NEB);
then ligated together, using T4 ligase and 10x buffer (Promega).
The correct insertion was confirmed by PCR and with Sanger Sequencing (5’ UTR confirmation primer: 5’-CGACCGAGCGCAGCGAGTCA-3’; 3’ UTR confirmation primer: SP6).

Please visit https://doi.org/10.1101/2024.03.22.582209 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJM-RMC-01 was a gift from Richard McCulloch (Addgene plasmid # 248660 ; http://n2t.net/addgene:248660 ; RRID:Addgene_248660)
  • For your References section:

    DNA damage drives antigen diversification in Trypanosoma brucei. Smith JE, Wang KJ, Kennedy EM, Munday JC, Singer L, Hakim JMC, So J, Beaver AK, Magesh A, Gilligan-Steinberg SD, Zheng J, Zhang B, Moorthy DN, Brown ZE, Akin EH, Mwakibete L, McCulloch R, Mugnier MR. Nature. 2026 Apr 8. doi: 10.1038/s41586-026-10337-6. 10.1038/s41586-026-10337-6 PubMed 41951731