pJM-RMC-03
(Plasmid #248661)

• Purpose: (Empty Backbone) Knockout plasmid for T. brucei RAD51 with BSD-TK
• Depositing Lab: Richard McCulloch
• Depositing Organization: University of Glasgow
  Located in United Kingdom of Great Britain and Northern Ireland
• Publication: DNA damage drives antigen diversification through mosaic VSG formation in Trypanosoma brucei (unpublished)

Backbone

• Vector backbone: pyrFEKO-BSD
• Backbone manufacturer: George Cross (Addgene # 24024)
• Backbone size (bp): 5600
• Vector type: Trypanosoma knock out plasmid
• Selectable markers: Blasticidin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: CGACCGAGCGCAGCGAGTCA
• 3′ sequencing primer: GTGTCACCTAAA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Plasmid and pJM-RMC-03 was made by swapping the relevant UTRs of EATRO1125 RAD51(Tb1125.11.8190) into pyrFEKO-BSD using restriction enzyme cloning. (pyrFEKO-BSD: Addgene plasmid # 24024; http://n2t.net/addgene:24024)
Briefly, UTRs were amplified from EATRO1125 90:13 gDNA with Phusion polymerase (NEB; 5’ UTR = F 5’-CAGCTGCGGCCGCAGGCAGTCAAAGCATGTCCA-3’ and R 5’-TCTAGAAGCTTCCCTGATATACGCGTTAAGA-3’; 3’ UTR = F 5’- GGATCCATGCATTTCCTCATCATTTGTAGAA-3’ and R 5’-CCTGCAGGCTCGAGAGTTACCTACAATTGCCTTC-3’) then ligated into pGEM-T Easy Vector (Promega) and confirmed via Sanger sequencing (Eurofins, Germany; with M13F).
Plasmid and inserts were digested with the following:
1) for the 5’UTR, PvuII-HF and HindIII-HF (both NEB)
2) for the 3’UTR, BamHI-HF and SbfI-HF (both NEB);
then ligated together, using T4 ligase and 10x buffer (Promega).
The correct insertion was confirmed by PCR and with Sanger Sequencing (5’ UTR confirmation primer: 5’-CGACCGAGCGCAGCGAGTCA-3’; 3’ UTR confirmation primer: SP6).

Please visit https://doi.org/10.1101/2024.03.22.582209 for bioRxiv preprint.