Skip to main content

pCS2+Brd9 (zebrafish) partial UTR and coding sequence-EGFP
(Plasmid #248787)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 248787 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pCS2+
  • Backbone size w/o insert (bp) 4817
  • Total vector size (bp) 4998
  • Vector type
    Brd9(zebrafish)-EGFP reporter

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    brd9
  • Species
    D. rerio (zebrafish)
  • Entrez Gene
    brd9 (a.k.a. zgc:55797)
  • Promoter partial 5'UTR sequence of zebrafish brd9
  • Tag / Fusion Protein
    • EGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamH1 (not destroyed)
  • 3′ cloning site EcoR1 (not destroyed)
  • 5′ sequencing primer gcaagcttgatttaggtgaca
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCS2+Brd9 (zebrafish) partial UTR and coding sequence-EGFP was a gift from Wenyan Ren (Addgene plasmid # 248787 ; http://n2t.net/addgene:248787 ; RRID:Addgene_248787)
  • For your References section:

    Integrative analysis reveals synergistic regulation of Sp7 by BRD9 and Wnt/beta-catenin signaling during osteogenic differentiation. Wu L, Wang L, Zhuang Y, Luo Y, Zhu Q, Maimaitizunong M, Wang Y, Cheng Z, Li Y, Sheng X, Li M, Luo Q, Jiang X, Lei S, Lin X, Zhong Y, Ren W. Commun Biol. 2025 Dec 1. doi: 10.1038/s42003-025-09278-z. 10.1038/s42003-025-09278-z PubMed 41326797