pKMDDV_Plasmid_1
(Plasmid #249037)

• Purpose: Plasmid 1 containing constitutively expressed dCas9 and RBP-AD along with inducible scRNA_RFP
• Depositing Lab: Domitilla Del Vecchio
• Publication: Aravind et al Cell Systems, 2026; 17

Backbone

• Vector backbone: pCK005.6
• Backbone size w/o insert (bp): 8073
• Total vector size (bp): 7849
• Modifications to backbone: Inducible promoter for scRNA Change in antibiotic resistance dCas9 promoter modifications Minor modifications and mutations
• Vector type: Bacterial Expression, CRISPR, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: dCas9
• Species: Synthetic; S. pyogenes
• Insert Size (bp): 4107
• Promoter: BBa_J23116

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GAATTCGCGGCCGCTTCTAGAG

Gene/Insert 2

• Gene/Insert name: MCP-SoxS(R93A/S101A)
• Species: Synthetic
• Insert Size (bp): 696
• Promoter: BBa_J23107

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: caattcagggtggtgaatctgc

Gene/Insert 3

• Gene/Insert name: scRNA
• Species: Synthetic
• Insert Size (bp): 111
• Promoter: PphlF

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: gtcagccccatacgatataagttgttactag

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry