pKMDDV_Plasmid_2b
(Plasmid
#249057)
-
PurposePlasmid 2b containing RFP with J306 scRNA binding site, GFP with J108 scRNA binding site and a constitutively expressed scRNA_GFP
-
Depositing Lab
-
Depositing OrganizationMassachusetts Institute of Technology
Located in United States of America -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 249057 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepJF143.J3
- Backbone size w/o insert (bp) 4431
- Total vector size (bp) 5716
-
Modifications to backboneAdditional constitutive scRNA_GFP and GFP
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert namescRNA
-
SpeciesSynthetic
-
Insert Size (bp)250
- Promoter ptrc
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer cccaatgtacaagcaacccgag
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameFast Folding Green Fluorescent Protein
-
Alt nameff GFP
-
Alt nameGFP
-
SpeciesSynthetic
-
Insert Size (bp)1000
- Promoter BBa_J23117
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer ggagtgcgatgcagCCTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKMDDV_Plasmid_2b was a gift from Domitilla Del Vecchio (Addgene plasmid # 249057 ; http://n2t.net/addgene:249057 ; RRID:Addgene_249057) -
For your References section:
Resource competition shapes CRISPR-mediated gene activation. Aravind KM, Del Vecchio D. Cell Systems, 2026; 17 10.1016/j.cels.2025.101511