pLentiCRISPRv2_hPTK7-gRNA2
(Plasmid
#249197)
-
Purposehuman PTK7 CRISPR KO
-
Depositing Lab
-
Depositing OrganizationHangzhou Institute of Medicine, Chinese Academy of Sciences
Located in China -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 249197 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneLentiCRISPR v2
-
Backbone manufacturerFeng Zhang, Addgene plasmid #52961
-
Vector typeLentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePTK7
-
gRNA/shRNA sequenceGCTGCAGGACTCACGGTTCG
-
SpeciesH. sapiens (human)
-
Entrez GenePTK7 (a.k.a. CCK-4, CCK4)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLentiCRISPRv2_hPTK7-gRNA2 was a gift from Weihong Tan (Addgene plasmid # 249197 ; http://n2t.net/addgene:249197 ; RRID:Addgene_249197) -
For your References section:
SPARK-seq: A high-throughput platform for aptamer discovery and kinetic profiling. Luo G, Song J, Fu Y, Jiang Y, Gao Y, Zhong Z, Li L, Wei Y, Jia HR, Guo L, Fu T, Wu Q, Tan W. Science. 2026 Jan;391(6780):eadv6127. doi: 10.1126/science.adv6127. Epub 2026 Jan 1. 10.1126/science.adv6127 PubMed 41477891