Skip to main content

pLentiCRISPRv2_mPTK7-gRNA3
(Plasmid #249198)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 249198 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    LentiCRISPR v2
  • Backbone manufacturer
    Feng Zhang, Addgene plasmid #52961
  • Vector type
    Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PTK7
  • gRNA/shRNA sequence
    GAGGCCACTATGTTCGGGAC
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Ptk7 (a.k.a. 8430404F20Rik, chz, mPTK7/CCK4)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLentiCRISPRv2_mPTK7-gRNA3 was a gift from Weihong Tan (Addgene plasmid # 249198 ; http://n2t.net/addgene:249198 ; RRID:Addgene_249198)
  • For your References section:

    SPARK-seq: a high-throughput platform for aptamer discovery and kinetic profiling. Guoyan Luo et al. Science391,eadv6127(2026) 10.1126/science.adv6127