pCAG-mouse Slc9c1 (ΔExchanger)-PA
(Plasmid
#249414)
-
PurposeExpression vector of mouse Slc9c1(aa588-1175) tagged with PA at C-terminus under the CAG promoter
-
Depositing Lab
-
Depositing OrganizationThe University of Osaka
Located in Japan -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 249414 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCAG1.1
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSlc9c1
-
SpeciesM. musculus (mouse)
-
Mutationdeleted amino acids 1-587
-
Entrez GeneSlc9c1 (a.k.a. Gm610, NHE-10, Slc9a10, sNHE, spermNHE)
- Promoter CAG
-
Tag
/ Fusion Protein
- PA (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer GCCTTCTTCTTTTTCCTACAGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-mouse Slc9c1 (ΔExchanger)-PA was a gift from Masahito Ikawa (Addgene plasmid # 249414 ; http://n2t.net/addgene:249414 ; RRID:Addgene_249414) -
For your References section:
Formation of a complex between TMEM217 and the sodium-proton exchanger SLC9C1 is crucial for mouse sperm motility and male fertility. Iida-Norita R, Miyata H, Ninomiya A, Emori C, Kamoshita M, Pan C, Wang H, Ikawa M. Proc Natl Acad Sci U S A. 2025 Oct 21;122(42):e2513924122. doi: 10.1073/pnas.2513924122. Epub 2025 Oct 15. 10.1073/pnas.2513924122 PubMed 41091759