Skip to main content

U6-sgRNA_HPRT1_ex3-CBh-3xFLAG-NLS-Cas9-NLS-T2A-mCherry
(Plasmid #250373)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 250373 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pU6-(BbsI)_CBh-Cas9-T2A-mCherry
  • Backbone manufacturer
    Ralf Kuehn (Addgene #64324)
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgHPRT1
  • gRNA/shRNA sequence
    agccccccttgagcacacag
  • Species
    H. sapiens (human)
  • Entrez Gene
    HPRT1 (a.k.a. HGPRT, HPRT)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (destroyed during cloning)
  • 3′ cloning site BbsI (destroyed during cloning)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    U6-sgRNA_HPRT1_ex3-CBh-3xFLAG-NLS-Cas9-NLS-T2A-mCherry was a gift from Stefan Kubicek (Addgene plasmid # 250373 ; http://n2t.net/addgene:250373 ; RRID:Addgene_250373)
  • For your References section:

    A non-enzymatic role of Nudix hydrolase 5 in repressing purine de novo synthesis. Nguyen TA, Lin JG, Marques AMC, Fottner M, Bauer LG, Reicher A, Daum D, Scrofani L, Liu Y, Cheng C, D'Angelo L D D L, Sanchez J, Bueschl C, Marella N, Buphamalai P, Traversi F, Beres M, Moll HP, Siklos M, Genger JW, Hofstaetter G, Villanti L, Malik M, Klimek C, Runggatscher K, Guertl B, Hansen JS, Dobner S, Babosova O, Becirovic T, de Rooij LPMH, Casanova E, Koren A, Froese DS, Rosenblatt DS, Klavins K, Bergthaler A, Menche J, Hannich JT, Abele M, Sdelci S, Lang K, Huber KVM, Kubicek S. Science. 2025 Nov 6:eadv4257. doi: 10.1126/science.adv4257. 10.1126/science.adv4257 PubMed 41196952