pLexM-HsPQLC1(Δ100-125/GGGS/Δ257-271)-FLAG
(Plasmid
#250423)
-
PurposeExpression of C-terminally FLAG-Tagged HsPQLC1 (Δ100-125 - with these residues replaced by a GGGS Linker; Δ257-271) in Mammalian Cells
-
Depositing Lab
-
Depositing OrganizationUniversity of Oxford
Located in the United Kingdom of Great Britain and Northern Ireland -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 250423 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLexM
-
Backbone manufacturerEdith Yvonne Jones (Addgene # 99844)
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePQLC1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)702
-
MutationΔ100-125 (Replaced with GGGS), Δ257-271
-
Entrez GeneSLC66A2 (a.k.a. PQLC1)
- Promoter Chicken-beta-actin promoter/CMV Enhancer
-
Tag
/ Fusion Protein
- FLAG (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SacI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer GCTGGTTGTTGTGCTGTCTCATC
- 3′ sequencing primer ATCACCATCTAATTCAACCAA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLexM-HsPQLC1(Δ100-125/GGGS/Δ257-271)-FLAG was a gift from Simon Newstead (Addgene plasmid # 250423 ; http://n2t.net/addgene:250423 ; RRID:Addgene_250423)