pUBC-SV40NLS-PopZ3H-QtE-TSapphire
(Plasmid
#250610)
-
PurposeMammalian lentiviral vector for the expression of the Sapphire-tagged nuclear localizing 50nm nucQtE-GEMs under the UBC promoter
-
Depositing Lab
-
Depositing OrganizationNYU Grossman School of Medicine
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 250610 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonelentiviral vector
- Total vector size (bp) 9342
-
Vector typeMammalian Expression, Bacterial Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameEncapsulin
-
SpeciesQuasibacillus thermotolerans
-
Insert Size (bp)846
-
MutationSV40NLS signal on N-terminal
-
Tags
/ Fusion Proteins
- TSapphire (C terminal on insert)
- PopZTag (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CCAAAAAAGAAGAGAAAGGTCTCTAGAGAGGTCGCAGAGCAGCTGGTT
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySV40NLS was cloned into Addgene #240101 by Cindy Hernandez
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.06.20.660750 for our bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUBC-SV40NLS-PopZ3H-QtE-TSapphire was a gift from Liam Holt (Addgene plasmid # 250610 ; http://n2t.net/addgene:250610 ; RRID:Addgene_250610) -
For your References section:
Herpes simplex virus 1 fluidizes the nucleus, enabling condensate formation. Herzog NL, Shu T, Kidiyoor GR, Keegan S, Korchi F, Chenoweth DM, Zhang H, Mohr I, Wilson AC, Holt LJ. Mol Cell. 2026 Mar 5;86(5):817-833.e7. doi: 10.1016/j.molcel.2026.02.005. 10.1016/j.molcel.2026.02.005 PubMed 41795434