pUBC-SV40NLS-HoTag3-Shunzhi12nm-TSapphire
(Plasmid #250617)

• Purpose: Mammalian lentiviral vector for the expression of the Sapphire-tagged nuclear localizing 12nm nanoGEMs under the UBC promoter
• Depositing Lab: Liam Holt
• Depositing Organization: NYU Grossman School of Medicine
  Located in United States of America
• Publication: Herzog et al Mol Cell. 2026 Mar 5;86(5):817-833.e7. doi: 10.1016/j.molcel.2026.02.005.

Backbone

• Vector backbone: lentiviral vector
• Backbone size w/o insert (bp): 7461
• Total vector size (bp): 8544
• Vector type: Mammalian Expression, Bacterial Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: 12nm Shunzhi 60mers
• Alt name: PDB 8f53
• Alt name: Shunzhi-60mer
• Species: Synthetic
• Insert Size (bp): 162
• Promoter: pUBC
• Tags / Fusion Proteins:
  • 4X(GGGGS) linker (C terminal on insert)
  • TSapphire (C terminal on insert)
  • HOTag3 (N terminal on insert)
  • SV40NLS (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ATTGCTAAGTCCCTCAAGGGATCTAGAATGATGGAGGCCATGGTG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Synthetic construct for 12nm-nucGEMs originally cloned from PDB 8f53, associated with DOI: 10.1126/science.adf6591

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://doi.org/10.1101/2025.06.20.660750 for our bioRxiv preprint.