pRD661
(Plasmid
#251525)
-
PurposeOverexpresses HTkC R45A in E. coli cells
-
Depositing Lab
-
Depositing OrganizationLeiden University
Located in Netherlands -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 251525 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepET30b
- Backbone size w/o insert (bp) 5204
- Total vector size (bp) 5384
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHTkC R45A
-
Alt nameTK1040 R45A
-
Alt nameQ5JDW7 R45A
-
SpeciesSynthetic
-
Insert Size (bp)180
-
MutationChanged Arginine 45 to Alanine
- Promoter T7 promotor
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.64898/2025.12.06.692711v1 for the relevant bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRD661 was a gift from Remus Dame (Addgene plasmid # 251525 ; http://n2t.net/addgene:251525 ; RRID:Addgene_251525) -
For your References section:
Archaeal histone HTkC hypercompacts DNA. Schwab S, Hu Y, Yamamoto S, Yamaura K, Takemata N, Hartmann MD, Cajili MKM, van Erp B, Atomi H, Alva V, Alvarez BH, Dame RT. bioRxiv 2025.12.06.692711; doi: 10.64898/2025.12.06.692711 10.64898/2025.12.06.692711