sgRNA-msIM83
(Plasmid
#251968)
-
PurposesgRNA for yeast mtDNA editing, with IM83 aptamer inserted into the major stem-loop of the sgRNA
-
Depositing Lab
-
Depositing OrganizationStanford University
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 251968 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepAG415
-
Vector typeYeast Expression, CRISPR
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA-msIM83
-
gRNA/shRNA sequenceAGCTTAGTGATGTAAGATTT
-
SpeciesSynthetic
- Promoter SNR52
Cloning Information
- Cloning method Gibson Cloning
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.64898/2025.12.09.693232 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
sgRNA-msIM83 was a gift from Alice Ting (Addgene plasmid # 251968 ; http://n2t.net/addgene:251968 ; RRID:Addgene_251968) -
For your References section:
Towards CRISPR-based editing of the mitochondrial genome in yeast. Yin S, Jarosz DF, Ting AY. Proc Natl Acad Sci U S A. 2026 Jan 20;123(3):e2505894123. doi: 10.1073/pnas.2505894123. Epub 2026 Jan 16. 10.1073/pnas.2505894123 PubMed 41543903