pCMV-HT9-FKBP12F36V-eGFP-NMNAT1-SV40polyA
(Plasmid
#252091)
-
PurposeExpresses HT9-FKBP12F36V-eGFP-NMNAT1 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 252091 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepCMV
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHT9-FKBP12F36V-eGFP-NMNAT1
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.26434/chemrxiv-2024-k3074 for ChemRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-HT9-FKBP12F36V-eGFP-NMNAT1-SV40polyA was a gift from Karl Deisseroth (Addgene plasmid # 252091 ; http://n2t.net/addgene:252091 ; RRID:Addgene_252091) -
For your References section:
Genetically targeted photocatalytic organic dyes for spatiotemporally controlled organic synthesis in specific living cells. Zhao S, Loh KY, Tyson J, Kadur C, Bertozzi CR, Deisseroth K, Bao Z. Nat Chem. 2026 Jul 8. doi: 10.1038/s41557-026-02195-6. 10.1038/s41557-026-02195-6 PubMed 42420503