35S:GOLD (pICSL11383)
(Plasmid
#252523)
-
PurposeLevel 1 plasmid in second position containing 35S:GOLD (pICSL11383)
-
Depositing Lab
-
Depositing OrganizationSainsbury Laboratory, Norwich
Located in the United Kingdom of Great Britain and Northern Ireland -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 252523 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepICH47742_mRFP1
-
Vector typePlant Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGOLD
- Promoter Short 35s + Ω
Cloning Information
- Cloning method Golden Gate
- 5′ sequencing primer CTGGTGGCAGGATATATTGTGGTG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.64898/2026.01.14.699277 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
35S:GOLD (pICSL11383) was a gift from Sophien Kamoun (Addgene plasmid # 252523 ; http://n2t.net/addgene:252523 ; RRID:Addgene_252523) -
For your References section:
AMBER and GOLD: Polycistronic Genes for Betaxanthin Production in Plants. Desnoyer N, Hill L, Youles M, Kamoun S. bioRxiv 2026.01.14.699277 10.64898/2026.01.14.699277