pAL0005
(Plasmid
#252720)
-
PurposeExpresses dox-controlled EGFP and miR-E shRNA targeting OTUD5
-
Depositing Labs
-
Depositing OrganizationCancer Research UK Cambridge Institute (CRUK-CI), University of Cambridge
Located in United Kingdom of Great Britain and Northern Ireland -
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 252720 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneLT3GEPIR
- Backbone size w/o insert (bp) 10147
- Total vector size (bp) 10272
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameshOTUD5-3
-
gRNA/shRNA sequenceAACAGCAGATGCTAGAAGACAA
-
SpeciesH. sapiens (human)
-
Entrez GeneOTUD5 (a.k.a. DUBA, MCAND)
- Promoter TRE3G
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer catggtcctgctggagttcgtg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAL0005 was a gift from James Brenton & Carlos Caldas (Addgene plasmid # 252720 ; http://n2t.net/addgene:252720 ; RRID:Addgene_252720)