pRRL.PPT-SFFV-MCS-IRES2-tdTomato
(Plasmid
#252769)
-
PurposeLentiviral overexpression of a gene of interest cloned into MCS; co-expresses tdTomato
-
Depositing Lab
-
Depositing OrganizationCenter for Neuroscience and Cell Biology, University of Coimbra
Located in Portugal -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 252769 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepRRL.PPT-SFFV-MCS-IRES2
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametdTomato
-
SpeciesDiscosoma sp.
-
Insert Size (bp)687
- Promoter SFFV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer cgtggttttcctttgaaaaacacgatg
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRRL.PPT-SFFV-MCS-IRES2-tdTomato was a gift from Filipe Pereira (Addgene plasmid # 252769 ; http://n2t.net/addgene:252769 ; RRID:Addgene_252769) -
For your References section:
Canonical and isomiR products of miR-142 enhance dendritic cell reprogramming. Arh N, Kurochkin I, Vaz BL, Schaefer D, Geukens C, Rosa FF, Pereira CF. Cell Rep. 2026 Aug 12;45(8):117825. doi: 10.1016/j.celrep.2026.117825. 10.1016/j.celrep.2026.117825 PubMed 42593968