Skip to main content

pLRK35
(Plasmid #253104)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 253104 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    JD633
  • Total vector size (bp) 25798
  • Modifications to backbone
    linking of SpCas9 with RUBY with P2A and cloning of two gRNAs
  • Vector type
    Plant Expression, CRISPR, Synthetic Biology
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    EPI300
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    SpCas9-P2A-RUBY
  • gRNA/shRNA sequence
    ACATCTTCGGCACCATCTGG, ATCCTGGTCACCATGCTCAT
  • Species
    Triticum aestivum and Triticum turgidum
  • Promoter ZmUbi1

Cloning Information

  • Cloning method Gene Synthesis
  • 5′ sequencing primer gacgagatcatcgagcaaatct
  • 3′ sequencing primer cgagtctgagggaaatgagtg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The backbone was derived from JD633 (Addgene #160393), and the RUBY gene from 35S: RUBY (Addgene #160908).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.64898/2026.02.10.705172 for bioRxiv preprint.

The reference articles to construct this plasmid:

A GRF-GIF chimeric protein improves the regeneration efficiency of transgenic plants. Debernardi JM, Tricoli DM, Ercoli MF, Hayta S, Ronald P, Palatnik JF, Dubcovsky J. Nat Biotechnol. 2020 Oct 12. pii: 10.1038/s41587-020-0703-0. doi: 10.1038/s41587-020-0703-0. 10.1038/s41587-020-0703-0 PubMed 33046875

A reporter for noninvasively monitoring gene expression and plant transformation. He Y, Zhang T, Sun H, Zhan H, Zhao Y. Hortic Res. 2020 Sep 19;7:152. doi: 10.1038/s41438-020-00390-1. eCollection 2020. 10.1038/s41438-020-00390-1 PubMed 33024566

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLRK35 was a gift from Ksenia Krasileva (Addgene plasmid # 253104 ; http://n2t.net/addgene:253104 ; RRID:Addgene_253104)
  • For your References section:

    Tracking Transgenes with Color: RUBY as a Visual Marker in CRISPR-Edited Mutant Plants in Two Triticum Species. Kumar R, Palayur A, Lunde C, Krasileva KV, Milner MJ. bioRxiv 2026.02.10.705172 10.64898/2026.02.10.705172