pLRK36
(Plasmid
#253105)
-
PurposeExpresses SpCas9-P2A-RUBY under ZmUbi1 promoter and two gRNAs for targeting NAC21/22 genes in wheat
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 253105 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneJD633
- Total vector size (bp) 25797
-
Modifications to backbonelinking of SpCas9 with RUBY with P2A and cloning of two gRNAs
-
Vector typePlant Expression, CRISPR, Synthetic Biology
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)EPI300
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSpCas9-P2A-RUBY
-
gRNA/shRNA sequenceGATGAGCTTCCTGAGCATGG, CTGCGACTACCTCGCGCCCA
-
SpeciesTriticum aestivum and Triticum turgidum
- Promoter ZmUbi1
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer gacgagatcatcgagcaaatct
- 3′ sequencing primer cgagtctgagggaaatgagtg
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe backbone was derived from JD633 (Addgene #160393), and the RUBY gene from 35S: RUBY (Addgene #160908).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.64898/2026.02.10.705172 for bioRxiv preprint.
The reference articles to construct this plasmid:
A GRF-GIF chimeric protein improves the regeneration efficiency of transgenic plants. Debernardi JM, Tricoli DM, Ercoli MF, Hayta S, Ronald P, Palatnik JF, Dubcovsky J. Nat Biotechnol. 2020 Oct 12. pii: 10.1038/s41587-020-0703-0. doi: 10.1038/s41587-020-0703-0. 10.1038/s41587-020-0703-0 PubMed 33046875
A reporter for noninvasively monitoring gene expression and plant transformation. He Y, Zhang T, Sun H, Zhan H, Zhao Y. Hortic Res. 2020 Sep 19;7:152. doi: 10.1038/s41438-020-00390-1. eCollection 2020. 10.1038/s41438-020-00390-1 PubMed 33024566
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLRK36 was a gift from Ksenia Krasileva (Addgene plasmid # 253105 ; http://n2t.net/addgene:253105 ; RRID:Addgene_253105) -
For your References section:
Tracking Transgenes with Color: RUBY as a Visual Marker in CRISPR-Edited Mutant Plants in Two Triticum Species. Kumar R, Palayur A, Lunde C, Krasileva KV, Milner MJ. bioRxiv 2026.02.10.705172 10.64898/2026.02.10.705172