PML-1 PXL domain
(Plasmid
#253216)
-
PurposeExpresses the PML-1 PXL domain in Bl21(DE3) cells
-
Depositing Lab
-
Depositing OrganizationUniversity of Connecticut Health Center
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 253216 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepET
- Backbone size w/o insert (bp) 5100
- Total vector size (bp) 5900
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namePXL (PML-1 578-861)
-
Alt namePML-1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)837
-
Mutationdeleted amino acids 1-577, 645-649, and 862-882.
-
GenBank IDNM_033238.3
-
Entrez GenePML (a.k.a. MYL, PP8675, RNF71, TRIM19)
-
Tags
/ Fusion Proteins
- 6xHIS (N terminal on backbone)
- SUMO (N terminal on backbone)
- TEV cleavage site (N terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer Sumo forward (5'ttattgaggctcacagagaac)
- 3′ sequencing primer T7 Reverse
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.64898/2026.02.19.706916 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PML-1 PXL domain was a gift from Irina Bezsonova (Addgene plasmid # 253216 ; http://n2t.net/addgene:253216 ; RRID:Addgene_253216) -
For your References section:
PXL: a Nucleic Acid-Binding Module of Promyelocytic Leukemia Protein. Fairchild D, Semenova IV, Geddes-Buehre D, Li Y, Szczepaniak R, Weller SK, Hao B, Bezsonova I. bioRxiv [Preprint]. 2026 Feb 20:2026.02.19.706916. doi: 10.64898/2026.02.19.706916. 10.64898/2026.02.19.706916 PubMed 41756868