Skip to main content

PML-1 PXL domain
(Plasmid #253216)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 253216 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pET
  • Backbone size w/o insert (bp) 5100
  • Total vector size (bp) 5900
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    PXL (PML-1 578-861)
  • Alt name
    PML-1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    837
  • Mutation
    deleted amino acids 1-577, 645-649, and 862-882.
  • GenBank ID
    NM_033238.3
  • Entrez Gene
    PML (a.k.a. MYL, PP8675, RNF71, TRIM19)
  • Tags / Fusion Proteins
    • 6xHIS (N terminal on backbone)
    • SUMO (N terminal on backbone)
    • TEV cleavage site (N terminal on backbone)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer Sumo forward (5'ttattgaggctcacagagaac)
  • 3′ sequencing primer T7 Reverse
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.64898/2026.02.19.706916 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PML-1 PXL domain was a gift from Irina Bezsonova (Addgene plasmid # 253216 ; http://n2t.net/addgene:253216 ; RRID:Addgene_253216)
  • For your References section:

    PXL: a Nucleic Acid-Binding Module of Promyelocytic Leukemia Protein. Fairchild D, Semenova IV, Geddes-Buehre D, Li Y, Szczepaniak R, Weller SK, Hao B, Bezsonova I. bioRxiv [Preprint]. 2026 Feb 20:2026.02.19.706916. doi: 10.64898/2026.02.19.706916. 10.64898/2026.02.19.706916 PubMed 41756868