Skip to main content
Addgene
Open Menu

ISceI-fabp10a-miR-21-1-Dendra2, cryaa:mCherry
(Plasmid #253623)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 253623 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart

Backbone

  • Vector backbone
    unknown
  • Total vector size (bp) 9857
  • Vector type
    Zebrafish expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    miR-21-1-Dendra2
  • Alt name
    dre-miR-21
  • Species
    D. rerio (zebrafish)
  • Entrez Gene
    dre-mir-21-1 (a.k.a. mir21-1)
  • Promoter fabp10a
  • Tag / Fusion Protein
    • Dendra2

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site XhoI (not destroyed)
  • 5′ sequencing primer GATACAGGTACCGCCACCAT
  • 3′ sequencing primer CGCTTACAATTTACGCCTTAAGATA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Modified from Addgene #97101

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.1101/2025.07.19.665686 for the bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ISceI-fabp10a-miR-21-1-Dendra2, cryaa:mCherry was a gift from Kimberley Evason (Addgene plasmid # 253623 ; http://n2t.net/addgene:253623 ; RRID:Addgene_253623)

  • For your References section:

    MicroRNA-21 promotes dysregulated lipid metabolism and hepatocellular carcinoma. VanSant-Webb C, Castro JC, Su AY, Hawkins K, Saxena A, Wright J, Smith R, Fragoso-Garcia M, Chen YA, Barton C, Stubben C, O'Connell RM, Ducker GS, Evason KJ. Dis Model Mech. 2026 Feb 1;19(2):dmm052583. doi: 10.1242/dmm.052583. Epub 2026 Mar 5. 10.1242/dmm.052583 PubMed 41582686
Related items: