ISceI-fabp10a-miR-21-1-Dendra2, cryaa:mCherry
(Plasmid
#253623)
-
PurposeOverexpress miR-21 in zebrafish liver
-
Depositing Lab
-
Depositing OrganizationUniversity of Utah
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 253623 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneunknown
- Total vector size (bp) 9857
-
Vector typeZebrafish expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemiR-21-1-Dendra2
-
Alt namedre-miR-21
-
SpeciesD. rerio (zebrafish)
-
Entrez Genedre-mir-21-1 (a.k.a. mir21-1)
- Promoter fabp10a
-
Tag
/ Fusion Protein
- Dendra2
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer GATACAGGTACCGCCACCAT
- 3′ sequencing primer CGCTTACAATTTACGCCTTAAGATA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byModified from Addgene #97101
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2025.07.19.665686 for the bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ISceI-fabp10a-miR-21-1-Dendra2, cryaa:mCherry was a gift from Kimberley Evason (Addgene plasmid # 253623 ; http://n2t.net/addgene:253623 ; RRID:Addgene_253623) -
For your References section:
MicroRNA-21 promotes dysregulated lipid metabolism and hepatocellular carcinoma. VanSant-Webb C, Castro JC, Su AY, Hawkins K, Saxena A, Wright J, Smith R, Fragoso-Garcia M, Chen YA, Barton C, Stubben C, O'Connell RM, Ducker GS, Evason KJ. Dis Model Mech. 2026 Feb 1;19(2):dmm052583. doi: 10.1242/dmm.052583. Epub 2026 Mar 5. 10.1242/dmm.052583 PubMed 41582686