pDGB1_alpha+mCherry
(Plasmid
#253731)
-
PurposeEncodes mCherry with an intron in the pDGB1-alpha backbone for plant expression. Requires pSOUP for replication in agrobacterium.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 253731 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepDGB1_alpha1
- Total vector size (bp) 4162
-
Vector typePlant Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemCherry
-
Insert Size (bp)841
- Promoter Cestrum yellow leaf curing virus promoter
Cloning Information
- Cloning method Other
- 5′ sequencing primer ccgatccccggaattagatc
- 3′ sequencing primer gggaaacgcctggtatcttt
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDGB1_alpha+mCherry was a gift from Markita Landry (Addgene plasmid # 253731 ; http://n2t.net/addgene:253731 ; RRID:Addgene_253731) -
For your References section:
Best Practices and Pitfalls in Developing Nanomaterial Delivery Tools for Plants. Squire HJ, Tomatz S, Wang JW, Gonzalez-Grandio E, Landry MP. ACS Nano. 2025 Jan 14;19(1):7-12. doi: 10.1021/acsnano.4c12116. Epub 2024 Dec 29. 10.1021/acsnano.4c12116 PubMed 39733396