Skip to main content

pLV_RHOT1 sgRNA_dCas9-KRAB-T2A-EGFP
(Plasmid #253810)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 253810 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pLV_sgRNA_dCas9-KRAB-T2A-GFP (addgene#71237)
  • Total vector size (bp) 14986
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA RHOT1
  • gRNA/shRNA sequence
    GGACAGCGCCAGCTCCGCCT
  • Species
    H. sapiens (human)
  • Entrez Gene
    RHOT1 (a.k.a. ARHT1, MIRO-1, MIRO1)
  • Promoter sgRNA for U6p and dCas9-KRAB-T2A-GFP for hUbCp

Cloning Information

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://doi.org/10.64898/2025.12.21.693523 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV_RHOT1 sgRNA_dCas9-KRAB-T2A-EGFP was a gift from Xinnan Wang (Addgene plasmid # 253810 ; http://n2t.net/addgene:253810 ; RRID:Addgene_253810)
  • For your References section:

    Optogenetic Proximity Labeling Maps Spatially Resolved Mitochondrial Surface Proteomes and a Locally Regulated Ribosome Pool. Kwak CS, Du Z, Creery JS, Wilkerson EM, Major MB, Elias JE, Wang X. bioRxiv [Preprint]. 2025 Dec 23:2025.12.21.693523. doi: 10.64898/2025.12.21.693523. 10.64898/2025.12.21.693523 PubMed 41497653