pLV_RHOT1 sgRNA_dCas9-KRAB-T2A-EGFP
(Plasmid
#253810)
-
PurposeExpress RHOT1 sgRNA under U6 promoter and dCas9-KRAB-T2A-EGFP under hUbC promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 253810 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepLV_sgRNA_dCas9-KRAB-T2A-GFP (addgene#71237)
- Total vector size (bp) 14986
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA RHOT1
-
gRNA/shRNA sequenceGGACAGCGCCAGCTCCGCCT
-
SpeciesH. sapiens (human)
-
Entrez GeneRHOT1 (a.k.a. ARHT1, MIRO-1, MIRO1)
- Promoter sgRNA for U6p and dCas9-KRAB-T2A-GFP for hUbCp
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ttattacagggacagcagagatccag
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.64898/2025.12.21.693523 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLV_RHOT1 sgRNA_dCas9-KRAB-T2A-EGFP was a gift from Xinnan Wang (Addgene plasmid # 253810 ; http://n2t.net/addgene:253810 ; RRID:Addgene_253810) -
For your References section:
Optogenetic Proximity Labeling Maps Spatially Resolved Mitochondrial Surface Proteomes and a Locally Regulated Ribosome Pool. Kwak CS, Du Z, Creery JS, Wilkerson EM, Major MB, Elias JE, Wang X. bioRxiv [Preprint]. 2025 Dec 23:2025.12.21.693523. doi: 10.64898/2025.12.21.693523. 10.64898/2025.12.21.693523 PubMed 41497653