pcDNA3.4_Emerin
(Plasmid
#253815)
-
PurposeUsed to overexpress emerin in mammalian cells with CMV promoter and pcDNA3.4 backbone.
-
Depositing Lab
-
Depositing OrganizationBrown University
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 253815 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepcDNA3.4
-
Backbone manufacturerGenScript
- Backbone size w/o insert (bp) 5964
- Total vector size (bp) 777
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameEmerin
-
SpeciesH. sapiens (human)
-
Insert Size (bp)6741
-
Entrez GeneEMD (a.k.a. EDMD, LEMD5, STA)
- Promoter CMV
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer ATAGAAGACACCGGGACCGA
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Synthesized through GenScript.
Please visit https://doi.org/10.1101/2025.10.15.682650 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.4_Emerin was a gift from Bess Frost (Addgene plasmid # 253815 ; http://n2t.net/addgene:253815 ; RRID:Addgene_253815) -
For your References section:
Elevation of the mechanically-sensitive e protein emerin links nuclear mechanotransduction to tau-induced cytoskeletal remodeling in neurons. Sohn C, Pardo S, Molleur D, Paduri SR, Lambert M, Uttke Z, Sohn EJ, Thomas MG, Weintraub ST, Frost B. Nucleus. 2026 Dec;17(1):2697135. doi: 10.1080/19491034.2026.2697135. Epub 2026 Jul 7. 10.1080/19491034.2026.2697135 PubMed 42415348