pKRB129
(Plasmid
#253817)
-
PurposeThis pMV361-derived E. coli-Mycobacterium shuttle vector contains the luxCDABE operon driven by the hsp60 promoter, as well as a kanamycin resistance cassette.
-
Depositing Lab
-
Depositing OrganizationJapan Institute for Health Security
Located in Japan -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 253817 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepMV361
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namelucCDABE
-
SpeciesPhotorhabdus luminescens
- Promoter hsp60
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer ctaagaataacgttggcactcgcgac
- 3′ sequencing primer GAGACACAACGTCGCTTTGTTGGCTAGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKRB129 was a gift from Manabu Ato (Addgene plasmid # 253817 ; http://n2t.net/addgene:253817 ; RRID:Addgene_253817) -
For your References section:
In vivo imaging identified efficient antimicrobial treatment against Mycobacterium marinum infection in mouse footpads. Yamamoto K, Torigoe S, Tsujimura Y, Asaka MN, Okumura K, Ato M. Sci Rep. 2024 Oct 17;14(1):24343. doi: 10.1038/s41598-024-75207-5. 10.1038/s41598-024-75207-5 PubMed 39420066