pJH2988
(Plasmid #253827)

• Purpose: MosSci Pges-1 GFP::DAF-16a unc-54 3 UTR C.elegans gut-specific expression of DAF-16 GFP
• Depositing Lab: Mei Zhen
• Publication: Three Muscle-Specific DAF-16/FOXO Transcriptional Targets Activated by Reduced Insulin/IGF-1 Signaling (unpublished)

Backbone

• Vector backbone: MosSci vector (Punc-119-mcs-att )
• Backbone size w/o insert (bp): 7400
• Total vector size (bp): 13600
• Vector type: Worm Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Pges-1 GFP:: daf-16
• Insert Size (bp): 6200
• Promoter: Pges-1
• Tag / Fusion Protein:
  • GFP (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (destroyed during cloning)
• 3′ cloning site: SpeI (not destroyed)
• 5′ sequencing primer: gcacatttaagatggaatcaaatggt
• 3′ sequencing primer: CTCACTAGTAGGAAACAGTTATGTTT

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit for https://www.biorxiv.org/content/10.1101/2021.09.21.461278v4 bioRxiv preprint.

There is a single nt discrepancy in Pgpc-1. This does not affect the plasmid's function.

Addgene found the following discrepancies in our result versus the depositor's reference:
2 SNPs in c. Briggsae unc-119(+); one results in premature stop codon Q157STOP
5 SNPs and 3bp indel in daf-16a

Comment from depositor: Functionally, the unc-119 Q7R gene does not affect it to rescue animals with unc-119 mutation. So it should be of no concern. The daf-16a SNPs and indel also do not appear to affect its function, expression or its ability to translocate from cytoplasm to nucleus.