pJH5133
(Plasmid #253862)

• Purpose: P C54F6.5 GFP::C54F6.5 3'UTR C54F6.5 transcriptional report
• Depositing Lab: Mei Zhen
• Publication: Three Muscle-Specific DAF-16/FOXO Transcriptional Targets Activated by Reduced Insulin/IGF-1 Signaling (unpublished)

Backbone

• Vector backbone: pBSK
• Backbone size w/o insert (bp): 4100
• Total vector size (bp): 6749
• Vector type: Worm Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GFP::C54F6.5 3'UTR
• Species: C. elegans (nematode)
• Insert Size (bp): 2649
• Promoter: P C54F6.5
• Tag / Fusion Protein:
  • GFP

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TGTGTTTGCTCAGTTTGCACCCGGGATTGGCCAAAGGACCCAAAG
• 3′ sequencing primer: AAGGGCCCGTACGGCCGACTAGTggggagccgaaagtgatgaggtt

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit for https://www.biorxiv.org/content/10.1101/2021.09.21.461278v4 bioRxiv preprint.

There is a single nt discrepancy in Pgpc-1. This does not affect the plasmid's function.

The EGFP in the plasmid has synthetic introns in it to help expression in C. elegans. The mutations or indels are all in the introns and does not affect the protein expression or function. We observed good GFP expression from the plasmid