pET-NtLS-Rca
(Plasmid #253864)

• Purpose: Expression of tobacco Rubisco large subunit, small subunit, and activase in E. coli
• Depositing Lab: Matthew D. Shoulders
• Depositing Organization: Massachusetts Institute of Technology
  Located in United States of America
• Publication: Machine learning-assisted directed evolution of plant Rubisco (unpublished)

Backbone

• Vector backbone: pET
• Backbone size w/o insert (bp): 5515
• Total vector size (bp): 8959
• Modifications to backbone: None
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: Room Temperature
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: Tobacco Rubisco small subunit
• Alt name: NtRbcS
• Species: Nicotiana tabacum
• Insert Size (bp): 372
• GenBank ID: P69249.1
• Promoter: T7

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: atgcaggtttggccgcctat

Gene/Insert 2

• Gene/Insert name: Tobacco Rubisco large subunit
• Alt name: NtRbcL
• Species: Nicotiana tabacum
• Insert Size (bp): 1434
• Mutation: V369A
• GenBank ID: P00876.2

Gene/Insert 3

• Gene/Insert name: Tobacco Rubisco activase
• Alt name: NtRca
• Species: Nicotiana tabacum
• Insert Size (bp): 1158
• GenBank ID: Q40460.1

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Prof. Spencer Whitney

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry