pCDF-NtAsmbl
(Plasmid #253865)

• Purpose: Expression of tobacco Rubisco chaperonin and assembly chaperones in E. coli
• Depositing Lab: Matthew D. Shoulders
• Depositing Organization: Massachusetts Institute of Technology
  Located in United States of America
• Publication: Machine learning-assisted directed evolution of plant Rubisco (unpublished)

Backbone

• Vector backbone: pCDF
• Backbone size w/o insert (bp): 3746
• Total vector size (bp): 11404
• Modifications to backbone: None
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: Room Temperature
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: NtRaf1
• Species: Nicotiana tabacum
• Insert Size (bp): 1173
• GenBank ID: XP_016475347.1
• Promoter: T7

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: atgtatcgattaaataagga

Gene/Insert 2

• Gene/Insert name: NtRaf2
• Species: Nicotiana tabacum
• Insert Size (bp): 488
• GenBank ID: XP_016516208.1

Gene/Insert 3

• Gene/Insert name: NtRbcX
• Species: Nicotiana tabacum
• Insert Size (bp): 354
• GenBank ID: XP_016509860.1

Gene/Insert 4

• Gene/Insert name: NtBSD2
• Species: Nicotiana tabacum
• Insert Size (bp): 246
• GenBank ID: AYR18863.1

Gene/Insert 5

• Gene/Insert name: NtCpn60α
• Species: Nicotiana tabacum
• Insert Size (bp): 1617
• GenBank ID: XP_016509320.1

Gene/Insert 6

• Gene/Insert name: NtCpn60β
• Species: Nicotiana tabacum
• Insert Size (bp): 1632
• GenBank ID: XP_016490465.2

Gene/Insert 7

• Gene/Insert name: NtCpn20
• Species: Nicotiana tabacum
• Insert Size (bp): 630
• GenBank ID: XP_016432480.1

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Prof. Spencer Whitney

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry