pHl-GGfpH
(Plasmid #253867)

• Purpose: Constitutively expresses GFP from the Harringtonia lauricola Gapdh promoter (hygromycin selection)
• Depositing Lab: Nemat Keyhani
• Depositing Organization: University of Illinois at Chicago
  Located in the United States of America
• Publication: Joseph et al Fungal Biol Biotechnol. 2026 Jul 23;13(1):13. doi: 10.1186/s40694-026-00217-z.

Backbone

• Vector backbone: pUC19
• Total vector size (bp): 7665
• Vector type: Bacterial Expression
• Selectable markers: Hygromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Pgpd-HPH-TU6-Pgpd-eGFP-TU6
• Species: Synthetic; Harringtonia lauricola, Aspergillus terreus
• Insert Size (bp): 5016
• Promoter: Harringtonia lauricola GPD

Cloning Information

• Cloning method: Gene Synthesis
• 5′ sequencing primer: CGGTCACAGCTTGTCTGTAAGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

H. lauricola GPD promoter sequence and eGFP sequence from Zhou et al., 2020; https://doi.org/10.1007/s00253-020-10762-1.

Hygromycin gene sequence from Nødvig et al., 2015; https://doi.org/10.1371/journal.pone.0133085.

A. terreus TU6 sequence from Chang et al., 2023; https://doi.org/10.1128/spectrum.04648-22.