pHl-GGfpH
(Plasmid
#253867)
-
PurposeConstitutively expresses GFP from the Harringtonia lauricola Gapdh promoter (hygromycin selection)
-
Depositing Lab
-
Depositing OrganizationUniversity of Illinois at Chicago
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 253867 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepUC19
- Total vector size (bp) 7665
-
Vector typeBacterial Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePgpd-HPH-TU6-Pgpd-eGFP-TU6
-
SpeciesSynthetic; Harringtonia lauricola, Aspergillus terreus
-
Insert Size (bp)5016
- Promoter Harringtonia lauricola GPD
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer CGGTCACAGCTTGTCTGTAAGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
H. lauricola GPD promoter sequence and eGFP sequence from Zhou et al., 2020; https://doi.org/10.1007/s00253-020-10762-1.
Hygromycin gene sequence from Nødvig et al., 2015; https://doi.org/10.1371/journal.pone.0133085.
A. terreus TU6 sequence from Chang et al., 2023; https://doi.org/10.1128/spectrum.04648-22.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHl-GGfpH was a gift from Nemat Keyhani (Addgene plasmid # 253867 ; http://n2t.net/addgene:253867 ; RRID:Addgene_253867) -
For your References section:
Genetic tools for transformation of Xyleborus ambrosia beetle fungal symbionts. Joseph RA, Masoudi A, Keyhani NO. Fungal Biol Biotechnol. 2026 Jul 23;13(1):13. doi: 10.1186/s40694-026-00217-z. 10.1186/s40694-026-00217-z PubMed 42487143