pJW2471
(Plasmid
#253925)
-
Purposelinker::mScarlet (GLO)::3xHA::linker for re-editing knock-in strains
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 253925 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepDONR221
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 2353
- Total vector size (bp) 3429
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name12aa linker::mScarlet (GLO)::3xHA::12aa linker
-
SpeciesC. elegans (nematode), Synthetic
-
Insert Size (bp)1023
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer M13 Forward (tgtaaaacgacggccagt)
- 3′ sequencing primer M13 Reverse (caggaaacagctatgaccatg)
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid contains four unique crRNA sites that can be used for re-editing the initial knock-in and inserting alternate cassettes. See this preprint for details: https://www.biorxiv.org/content/10.1101/2025.05.14.653803v1
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJW2471 was a gift from Jordan Ward (Addgene plasmid # 253925 ; http://n2t.net/addgene:253925 ; RRID:Addgene_253925)