pZac2.1 gfaABC1D-ARL13B-GFP
(Plasmid
#253928)
-
PurposeExpresses ARL13B-GFP in astrocytes (control for ARL13B-BioID2)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 253928 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepZac2.1
-
Backbone manufacturerKhakh lab
- Backbone size w/o insert (bp) 5097
- Total vector size (bp) 7113
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameARL13B-GFP
-
Alt nameADP-ribosylation factor-like protein 13B
-
Alt nameeGFP
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)2016
-
GenBank IDNM_001174150
-
Entrez GeneARL13B (a.k.a. ARL2L1, JBTS8)
- Promoter gfaABC1D
-
Tag
/ Fusion Protein
- eGFP (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer taatacgactcactatagg
- 3′ sequencing primer gtggtttgtccaaactcatc
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPaul DeCaen; ARL13B was cloned from Addgene plasmid #232880.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pZac2.1 gfaABC1D-ARL13B-GFP was a gift from Baljit Khakh (Addgene plasmid # 253928 ; http://n2t.net/addgene:253928 ; RRID:Addgene_253928)