pJH5155
(Plasmid #253948)

• Purpose: P C54F6.5 C54F6.5 SL2-NLS::mNeptune C54F6.5 3' UTR C54F6.5 transcriptional report
• Depositing Lab: Mei Zhen
• Publication: Three Muscle-Specific DAF-16/FOXO Transcriptional Targets Activated by Reduced Insulin/IGF-1 Signaling (unpublished)

Backbone

• Vector backbone: pBSK
• Backbone size w/o insert (bp): 5900
• Total vector size (bp): 7092
• Vector type: Worm Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SL2 NLS mNeptune
• Species: C. elegans (nematode)
• Insert Size (bp): 1192
• Promoter: P C54F6.5
• Tag / Fusion Protein:
  • RFP

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SmaI (destroyed during cloning)
• 3′ cloning site: DraIII (not destroyed)
• 5′ sequencing primer: CCCgctgtctcatcctacttt
• 3′ sequencing primer: CTCGTGCTGCTCGACGTAGGTCTC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit for https://www.biorxiv.org/content/10.1101/2021.09.21.461278v4 bioRxiv preprint.

There is a single nt discrepancy in Pgpc-1. This does not affect the plasmid's function.

The Addgene sequence result finds a 1bp indel at the 3' end of the ORF containing mCardinal that causes a premature stop codon. The indel does not affect the expression and localization of the NLS::mNeptune. The protein in the plasmid expresses a few amino acids past the final Lysine of mNeptune and therefore, the premature stop does not truncate any functional part of the fluorescent protein. We observed bright nuclear RFP signal with this plasmid.