pMVS1111a_Ptet_alsSD
(Plasmid
#254143)
-
PurposeAnhydrotetracycline-induced expression of acetolactate synthase and dehydrogenase in Methanothermobacter thermautotorphicusobacter
-
Depositing Lab
-
Depositing OrganizationUniversitaet Leipzig
Located in Germany -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 254143 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepMVS-V1
- Backbone size w/o insert (bp) 9202
- Total vector size (bp) 11617
-
Modifications to backboneincluding anhydrotetracycline-inducible expression system TetR/Ptet
-
Vector typeReplicative expression plasmid for archaeon Methanothermobacter thermautotrophicus
-
Selectable markersNeomycin
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameacetolactate synthase
-
Alt namealsS
-
Alt namelocus_tag = ST4052_04355
-
SpeciesStreptococcus thermophilus
-
Insert Size (bp)1677
-
Mutationcodon-optimized for Methanothermobacter thermautotrophicus
-
GenBank IDCP065476.1
- Promoter PhmtB with tetO1
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GTAATAGGTTCGAGCATGGCAACG
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameacetolactate decarboxylase
-
Alt namealsD
-
Alt namelocus_tag = ST4052_04360
-
Alt namebudA
-
SpeciesStreptococcus thermophilus
-
Insert Size (bp)723
-
Mutationcodon-optimized for Methanothermobacter thermautotrophicus
-
GenBank IDCP065476.1
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GCGTACTTTACGAAATCGACAGGAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMVS1111a_Ptet_alsSD was a gift from Bastian Molitor (Addgene plasmid # 254143 ; http://n2t.net/addgene:254143 ; RRID:Addgene_254143) -
For your References section:
Metabolic engineering of Methanothermobacter thermautotrophicus DeltaH for recombinant acetoin production. Baur T, Allaart MT, Zipperle A, Contreras G, Fink C, Angenent LT, Molitor B. Metab Eng Commun. 2026 Mar 18;22:e00275. doi: 10.1016/j.mec.2026.e00275. eCollection 2026 Jun. 10.1016/j.mec.2026.e00275 PubMed 41940165