pUG-amdSYM
(Plasmid
#254144)
-
PurposeCarries the Aspergillus nidulans expression cassette flanked by LoxP sites; suitable template for deletion cassettes containing the new marker module amdSYM
-
Depositing Lab
-
Depositing OrganizationDelft University of Technology
Located in the Netherlands -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 254144 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepUG6
-
Backbone manufacturerGüldener U, Heck S, Fiedler T, Beinhauer J, Hegemann JH. Nucleic Acids Research 1996; 24, 2519-2524
- Backbone size w/o insert (bp) 4009
- Total vector size (bp) 4807
-
Modifications to backboneThe coding sequence of the A. nidulans amdS gene, codon-optimized for expression in S. cerevisiae and flanked by the A. gossypii TEF2 promoter and terminator, was cloned into the vector pUG6 by replacing the KanMX gene, resulting in the plasmid pUG-amdSYM
-
Vector typeYeast Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameacetamidase
-
Alt nameamdS cDNA
-
SpeciesAspergillus nidulans
-
Insert Size (bp)1646
-
GenBank IDM16371
- Promoter TEF promoter from Ashbya gossypii
Cloning Information
- Cloning method Gene Synthesis
- 5′ sequencing primer GGGGGATCCATGCCACAATCTTGGGAAGAA
- 3′ sequencing primer GGGCTCGAGTTATGGAGTAACAAC
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUG-amdSYM was a gift from Jean-Marc Daran (Addgene plasmid # 254144 ; http://n2t.net/addgene:254144 ; RRID:Addgene_254144) -
For your References section:
amdSYM, a new dominant recyclable marker cassette for Saccharomyces cerevisiae. Solis-Escalante D, Kuijpers NG, Bongaerts N, Bolat I, Bosman L, Pronk JT, Daran JM, Daran-Lapujade P. FEMS Yeast Res. 2013 Feb;13(1):126-39. doi: 10.1111/1567-1364.12024. Epub 2012 Dec 17. 10.1111/1567-1364.12024 PubMed 23253382