Skip to main content

Setd7 knockdown miRNA
(Plasmid #254149)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 254149 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    AAV
  • Backbone manufacturer
    Princeton Neuroscience Institute Viral Core
  • Backbone size w/o insert (bp) 5277
  • Total vector size (bp) 5340
  • Vector type
    Mammalian Expression, AAV, RNAi
  • Selectable markers
    Not available

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Setd7
  • gRNA/shRNA sequence
    TCCGTGTACCACTTTGATAAATCGA
  • Species
    M. musculus (mouse)
  • GenBank ID
  • Entrez Gene
    Setd7 (a.k.a. 1600028F23Rik, H3K4MT, KMT7, Set7, Set7/9, mKIAA1717)
  • Promoter hSyn
  • Tag / Fusion Protein
    • EGFP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site HincII (not destroyed)
  • 5′ sequencing primer Unknown/Not available
  • 3′ sequencing primer Unknown/Not available
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Setd7 knockdown miRNA was a gift from Catherine Peña (Addgene plasmid # 254149 ; http://n2t.net/addgene:254149 ; RRID:Addgene_254149)
  • For your References section:

    Early-life stress alters H3K4me1 in VTA to prime stress sensitivity. Kim HJJ, Geiger LT, Balouek JA, Fang LZ, Barrett MR, Thompson JM, Farrelly LA, Hage T, Lin R, Chen AS, Tang M, Huang H, Buretta A, Chan A, Bennett SN, Garcia BA, Maze I, Creed MC, Pena CJ. Neuron. 2026 Aug 7:S0896-6273(26)00573-8. doi: 10.1016/j.neuron.2026.07.018. 10.1016/j.neuron.2026.07.018 PubMed 42567159