Setd7 knockdown miRNA
(Plasmid
#254149)
-
PurposeKnocks down Setd7 in mammalian cells and in vivo
-
Depositing Lab
-
Depositing OrganizationPrinceton University
Located in the United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 254149 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backboneAAV
-
Backbone manufacturerPrinceton Neuroscience Institute Viral Core
- Backbone size w/o insert (bp) 5277
- Total vector size (bp) 5340
-
Vector typeMammalian Expression, AAV, RNAi
-
Selectable markersNot available
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSetd7
-
gRNA/shRNA sequenceTCCGTGTACCACTTTGATAAATCGA
-
SpeciesM. musculus (mouse)
-
GenBank ID
-
Entrez GeneSetd7 (a.k.a. 1600028F23Rik, H3K4MT, KMT7, Set7, Set7/9, mKIAA1717)
- Promoter hSyn
-
Tag
/ Fusion Protein
- EGFP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site HincII (not destroyed)
- 5′ sequencing primer Unknown/Not available
- 3′ sequencing primer Unknown/Not available
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Setd7 knockdown miRNA was a gift from Catherine Peña (Addgene plasmid # 254149 ; http://n2t.net/addgene:254149 ; RRID:Addgene_254149) -
For your References section:
Early-life stress alters H3K4me1 in VTA to prime stress sensitivity. Kim HJJ, Geiger LT, Balouek JA, Fang LZ, Barrett MR, Thompson JM, Farrelly LA, Hage T, Lin R, Chen AS, Tang M, Huang H, Buretta A, Chan A, Bennett SN, Garcia BA, Maze I, Creed MC, Pena CJ. Neuron. 2026 Aug 7:S0896-6273(26)00573-8. doi: 10.1016/j.neuron.2026.07.018. 10.1016/j.neuron.2026.07.018 PubMed 42567159