TP1396
(Plasmid
#254447)
-
PurposeLentiviral expression construct for a 3xFLAG-BFP and ALFA-tagged anti-MBP nanobody driven by EF1α promoter.
-
Depositing Lab
-
Depositing OrganizationStanford University
Located in United States of America -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 254447 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbone#135448
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 10321
- Total vector size (bp) 11677
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameanti-MBP nanobody
-
SpeciesAlpaca (Vicugna pacos)
-
MutationContains engineered nanobody variant with ALFA tag.
- Promoter EF1α
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cttggttcattctcaagcctcag
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TP1396 was a gift from Tino Pleiner (Addgene plasmid # 254447 ; http://n2t.net/addgene:254447 ; RRID:Addgene_254447) -
For your References section:
The ER membrane protein complex acts as a chaperone to promote the biogenesis of multi-bundle membrane proteins. Stanton M, Singal B, Biswal M, Agarwal M, Scheuing CE, Vargas GD, Gao A, Gifford CA, Pleiner T. bioRxiv [Preprint]. 2026 Jan 15:2026.01.14.699575. doi: 10.64898/2026.01.14.699575. 10.64898/2026.01.14.699575 PubMed 41648177