pQCXIP-EGFP-CD59
(Plasmid
#254487)
-
PurposeEGFP reporter plasmid
-
Depositing Lab
-
Depositing OrganizationUniversity of Basel
Located in Switzerland -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 254487 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepQCXIP
-
Backbone manufacturerTakara Bio
- Backbone size w/o insert (bp) 7200
- Total vector size (bp) 8265
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCD59
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1089
-
Entrez GeneCD59 (a.k.a. 16.3A5, 1F5, EJ16, EJ30, EL32, G344, HRF-20, HRF20, MAC-IP, MACIF, MEM43, MIC11, MIN1, MIN2, MIN3, MIRL, MSK21, p18-20)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site PacI (not destroyed)
- 5′ sequencing primer ACGCCATCCACGCTGTTTTGACCT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pQCXIP-EGFP-CD59 was a gift from Dominik Buser (Addgene plasmid # 254487 ; http://n2t.net/addgene:254487 ; RRID:Addgene_254487) -
For your References section:
Golgi enzymes are retrieved from the plasma membrane to the trans-Golgi network. Buser DP, Junne T. FEBS Lett. 2026 Aug 15. doi: 10.1002/1873-3468.70438. 10.1002/1873-3468.70438 PubMed 42603102