Skip to main content

pQCXIP-EGFP-CD8-Furin
(Plasmid #254489)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 254489 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pQCXIP
  • Backbone manufacturer
    Takara Bio
  • Backbone size w/o insert (bp) 7200
  • Total vector size (bp) 8690
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Furin
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1519
  • Entrez Gene
    FURIN (a.k.a. FUR, PACE, PCSK3, SPC1)
  • Promoter CMV
  • Tags / Fusion Proteins
    • EGFP (N terminal on insert)
    • CD8 (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site PacI (not destroyed)
  • 5′ sequencing primer ACGCCATCCACGCTGTTTTGACCT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pQCXIP-EGFP-CD8-Furin was a gift from Dominik Buser (Addgene plasmid # 254489 ; http://n2t.net/addgene:254489 ; RRID:Addgene_254489)
  • For your References section:

    Golgi enzymes are retrieved from the plasma membrane to the trans-Golgi network. Buser DP, Junne T. FEBS Lett. 2026 Aug 15. doi: 10.1002/1873-3468.70438. 10.1002/1873-3468.70438 PubMed 42603102